CEEOL - Advanced Search

The Effect of Country of Origin and Country of Manufacture on Perceived Quality and Purchase Intention on Toyota Cars in West Nusa Tenggara, Indonesia

Author(s): Ni Wayan Sri Wulandari,Dwi Putra Buana Sakti,Handry Sudiartha Athar / Language(s): English / Issue: 12/2022

Keywords: Country of Origin; Country of Manufacture; Purchase Intention; Perceived Quality;

This study aims to determine and analyze the influence of Country of Origin and Country of Manufacture variables on Purchase Intention and Perceived Quality, as well as the impact of Perceived Quality variables on the Purchase Intention of Toyota Cars in West Nusa Tenggara. The type of research used is causal research. The population in this study was all consumers interested in buying a Toyota car at the Toyota Dealer in West Nusa Tenggara. The sample volume was 115 people, and the data analysis used was Structural Equation Modeling PLS. The results showed that the Country of Origin positively and significantly affects Purchase Intention and Perceived Quality. Variable Country of Manufacture has a positive and significant influence on Purchase Intention but has no significant impact on Perceived Quality. Perceived quality has a positive and significant effect on Purchase Intention. The results of this research can be input and consideration for companies in implementing development strategies.

More...

Situational Leadership of the School Principal in Improving Teacher's Pedagogic Competence In Kindergarten Gugus 2 UPTD 1 Johan Pahlawan, West Aceh District, Indonesia

Author(s): Syarifah Hardiyanti,Nasir Usman,Yusrizal Yusrizal / Language(s): English / Issue: 01/2023

Keywords: Situational leadership; pedagogic competence; education;

This study aimed to determine how the principal's instructive, consultative, participatory, and delegation styles improve teacher pedagogic competence in Kindergarten cluster 2 UPTD 1 Johan Pahlawan West Aceh District. This study uses a qualitative approach, namely the analysis and description of a symptom and phenomenon, attitudes, social activities and one's thoughts in both groups and individuals. According to the study, the principal's instructive style consists in improving teacher pedagogical competence. This can be seen in the principal's indicator of directing teachers to complete administrative tasks related to curriculum or syllabus development. The consultative style of the principal is more on the planning aspect of learning and implementation of knowledge. The principal's participative style increases teacher pedagogic competence on academic indicators. The delegation style of the principal delegates the task to a person deemed competent to complete the job when the top leaves school for official business and if the principal is sick.

More...

School Planning in Improving the Quality of Graduates of SMPN 3 Mataram, Indonesia

Author(s): Khaerul Rahman Akbar,Asrin Asrin,Lalu Sumardi / Language(s): English / Issue: 01/2023

Keywords: Management; Principal; Quality;

This study describes the principal's plan to improve the quality of SMPN 3 Mataram graduates. This research is qualitative. The data collection instruments used were observation, interviews, and documentation. Data analysis was done using data reduction, data presentation, triangulation, and conclusion. We check the validity of the data using the data credibility test, transferability, dependability, and confirmability. The results showed that the principal planning forms were curriculum management, personnel management, and student management planning. Suitable planning activities can improve the quality of graduates at SMPN 3 Mataram.

More...

The Influence of Work Discipline on the Quality of Private School Principles in East Lombok, Indonesia

Author(s): Nasrun Nasrun,Sudirman Sudirman,Asrin Asrin / Language(s): English / Issue: 01/2023

Keywords: Work Discipline; Work quality; Principal;

This study aims to determine the effect of work discipline on the work quality of private high school principals in East Lombok. The total sample is 45 school principals and uses the census. The method used for data collection is a questionnaire method. Data analysis used is descriptive analysis, prerequisite test and hypothesis testing, which includes linear regression analysis. The research results show that discipline significantly affects the quality of work of private high school principals in East Lombok Regency by 57.5% with p = 0.000. The more discipline increases, the work quality of school principals will also increase.

More...

Servant Leadership School Principles in Improving Teacher Performance at SMPN 7 Mataram, Indonesia

Author(s): Afjur Afjur,Sudirman Willian,Sudirman Sudirman / Language(s): English / Issue: 01/2023

Keywords: Servant Leadership; Teacher Performance; Principal;

This study describes servant leadership in improving teacher performance and building student character at SMPN 7 Mataram. The research approach used is qualitative with the case study method. Interview techniques, observation, and documentation studies were used for data collection. Checking the validity of the data is done by testing credibility, transferability, dependability, and confirmability. The study results show that the servant leadership of school principals can improve teacher performance, especially in discipline, with several efforts, namely supervising, providing motivation and increasing specialisation, activating school MGMP activities, and holding workshops.

More...

The Role of Educators and Education Personnel in Increasing the Quality of Education in STKIP Weeetebula, Indonesia

Author(s): Palli Poti,Joni Rohkmat,Lalu Muhaimi / Language(s): English / Issue: 01/2023

Keywords: Educator; Education Personnel; Education Quality;

The purpose of this study was to analyse the role of educators and education staff in ensuring quality education and the results of the strategy for developing educators and education staff at STKIP Weetebula. This research method is a descriptive qualitative method with a case study technique. Data collection techniques are observation, interviews, and documents. The research results show that the role of educators and education staff in improving the quality of education at STKIP Weetebula is very influential. Teachers at the school successfully follow the rules of the Education Act, according to which educators are professionals whose job is to plan and carry out the learning process, assess learning outcomes, conduct mentoring and training, and conduct research and community service, especially for educators at tertiary institutions.

More...

Measures by Organisations to Counter Challenges in the Use of Information Technology in Protecting Personal and Business Data in Nairobi County, Kenya

Author(s): Andrew Gitau Kimani / Language(s): English / Issue: 01/2023

Keywords: Information security challenges; personal and business data; information technology; measures;

Globally, most states have adopted new technologies that have seen many process improvements and cost optimisations and enabled them to provide value-added services to their citizens, thereby improving quality of life and achieving rapid growth and development in various sectors of the nation. Kenya is one of the developing countries that has benefited from adopting modern ICT in recent years. Despite government efforts to ensure the successful integration of ICT into various state departments and the private sector to protect and manage data, cases of document loss from individuals and institutions have been on the rise. This paper examined measures by organisations that could be adopted to counter challenges in using information technology to protect personal and business data in Nairobi County. The study’s target population comprised employees from Kenya Revenue Authority and Kenya Data Networks in Nairobi headquarter offices, police officers deployed at NPS offices headquarters and members of the public. The findings established that implementing electronic data management systems in organisations was more appropriate for controlling data loss. In addition, training employees on using the data management system is critical in preventing data loss in an organisation. Creating awareness of electronic data management systems was an effective measure to protect against data loss among organisations. Based on the findings, the paper concludes that strategies that help solve information challenges must be implemented to prevent data loss at personal and organisational levels.

More...

Strengthening the Police Institutional System in Eradicating Narcotics Crime in the North Sumatra Regional Police, Indonesia

Author(s): Dadang Hartanto / Language(s): English / Issue: 01/2023

Keywords: Strengthening; Police Institutional System; Eradicating Narcotics Crime;

This study aimed to analyse the strengthening of the institutional system in eradicating narcotics crimes in the North Sumatra Regional Police. This research was carried out using a qualitative approach involving collecting and analysing non-numeric data. The research unit is under the jurisdiction of the North Sumatra Regional Police. The results of this study indicate that strengthening the institutional system of the North Sumatra Regional Police is carried out in three ways, namely strengthening the institutional system, strengthening regulations and human resources and strengthening the internal control system. In practice, each procedure is carried out based on applicable laws. There is an abuse of authority by members of the police, so the strengthening of the internal police system must always be improved. Even though Itwasda has carried out internally the monitoring system for narcotics abuse, it still requires external parties, namely the community, to support the implementation of the oversight function of the actions of members of the police.

More...

Juridical Study of Arrangements for Authentic Deeds through Cyber Notary: Comparative Study with Japan

Author(s): Noval Dwi Kurnia,Muhammad Sood,Hirsanuddin Hirsanuddin / Language(s): English / Issue: 01/2023

Keywords: cyber-notary; Authentic deed; Notaryact;

This study aims to analyze cyber notary regulations in Indonesia and Japan, analyze the similarities and differences in cyber notary regulations in Indonesia and Japan and explore what benefits can be drawn from cyber notary regulations in Indonesia by using the theory of legal certainty, comparative law, legal system, and the idea of legal authority. The legal materials in this research are primary and secondary legal materials using normative research methods. According to the study, the concept of a cyber notary in Indonesia is still conceptual. At the same time, in Japan, the cyber-notary is regulated in law No 74 of 2011 concerning the Notary Act, which has differences related to Notary Organizations, procedures for carrying out cyber-notary, Certification Authority/Certified Service Providers, and witnesses.

More...

Comparison of Legal Authority of Notary and Electronic Signature Validity in Indonesia and the United States of America

Author(s): Ni Ketut Indah Primadani,Djumardi Djumardi,Aris Munandar / Language(s): English / Issue: 01/2023

Keywords: Notary Legal Authority; Signature Legitimacy;

The purpose of this research is to compare the analysis of the legal authority of a notary in Indonesia with the control of a notary in the United States. This is normative legal research with a statute, conceptual, and historical approach. According to a study, in carrying out their duties and positions, notaries in Indonesia are subject to and obedient to the law, which lies in the enactment for all of Indonesia. In contrast, in the United States, each state has its notary law. The legality of electronic signatures is valid in the eyes of the law when they meet several conditions. Electronic signatures must be certified to guarantee trust for the owner, namely in the form of authentication data. Any signature requirements under the law can be met in the states and territories where ESIGN is valid. In addition, electronic signatures can be presented as evidence and will survive in court as applicable. Uniform Electronic Transactions Act applies in some Indonesian states and territories.

More...

The Effectiveness of Multi-Agency Operation Leadership in Mitigating Insecurity in Lamu County, Kenya

Author(s): John K. Simiyu / Language(s): English / Issue: 01/2023

Keywords: Multiagency Operations; Collaboration; Security Formations; PSV Attacks; IED Attacks; Kenya; Lamu County;

There has been much discussion among various stakeholders on the benefits of multi-agency operations in response to security threats. This discussion is constrained, though, in that it downplays the complexity of multi-agency operations. Despite this, several nations, like Kenya, have used a multi-agency approach to deal with challenges related to national security; nevertheless, there is insufficient empirical evidence about the usefulness of this method in reducing insecurity issues. This study aimed to ascertain how well multi-agency operations leadership mitigated insecurity in Lamu County, Kenya. The collaborative advantage theory served as the basis for the investigation. This study used an ex post facto survey research design methodology. The study was carried out in Lamu County with a particular interest in the county's security personnel: an interview schedule and a questionnaire with structured and open-ended questions served as the data-gathering tools. The essential characteristics of the quantitative data gathered were displayed using descriptive statistics, including frequencies and percentages. Thematic analysis was used to create themes by grouping and open coding. The study discovered that multi-agency collaboration leadership successfully reduced insecurity in Lamu County. The study marked these out to address cases of inter-agency rivalry disputes, agency inferiority and superiority complexes, and the necessity to build a shared working policy on the ranking structure for the concerned agencies. The ongoing multiagency operation has made Lamu County, in general, safer and more stable. Researchers interested in the leadership efficacy of multi-agency procedures are expected to benefit from the findings of this study, as will policymakers in the security sector.

More...

The Effect of Instagram Content Quality on Fomsumerism Behavior with Emotional Response as a Mediating Variable

Author(s): Nadya Betari Karlinda,Sulhaini Sulhaini,Baiq Handayani Rinuastuti / Language(s): English / Issue: 01/2023

Keywords: Consumer Behavior; Instagram; Fomsumerism; Envy; Social Comparison; Imitation;

Social media growth has changed consumer behaviour from offline consumption to online consumption. Social media provide opportunities for information sharing, and can routinely find out what others are doing and talking about. Instagram is a social media platform with visual elements and features that can provide a more comfortable space for social interaction and a stronger sense of community or connection between fellow users. The rapid growth of social media plays a vital role in creating feelings of fear of being left behind or fear of missing out (FoMO). FoMO behaviour can impact consumption and give rise to a new concept, "Fomsumerism". This study aimed to determine the effect of Instagram content quality on fomsumerism behaviour mediated by emotional response variables. This type of quantitative research uses non-probability sampling methods and purposive sampling techniques on 150 respondents. An online survey collected data and analyzed using SEM-PLS through the SmartPLS application version 3.9.9. The study results show that the quality of Instagram content positively and significantly affects fomsumerism behaviour. Emotional response as a mediating variable plays a partial mediation role so that the Instagram content quality variable can affect the fomsumerism variable directly or indirectly.

More...

Forms of Non-Standard Employment in the Context of the Transformation of Business Processes in Modern Conditions

Author(s): Maryna Pravdiuk / Language(s): English / Issue: 01/2023

Keywords: non-standard employment; forms of work; business; business processes; outsourcing; outstaffing;

Modern business is dynamic and requires flexibility and quick response to societal changes. The conditions for forming market relations in Ukraine, characterised by the influence of a dynamic external environment and the growth of competition, require the search for innovative means of survival of enterprises and maintaining their efficiency. The purpose of the article is to study and summarise the theoretical aspects of the outstaffing process to identify the opportunities and threats associated with the participation in it of all subjects of this process, organisational and legal aspects of outstaffing, taking into account which will ensure the possible benefits of its implementation. Based on the analysis of literary sources and the study of practical experience in providing outstaffing services in Ukraine, the content of this process is determined. It is determined that outsourcing is one of the methods of cost optimisation at the present stage of enterprise development. The main scientific approaches to the definition of this concept, the classification of types are considered, and the main advantages and disadvantages of its use with an increase in the efficiency of the enterprise. The theoretical foundations of outsourcing in the enterprise are analysed to reduce production costs, improve quality and increase product competitiveness. Arguments have been formulated about recognising this toolkit as an effective means of minimising the costs of the enterprise, and some additional advantages of its use in a crisis economy are given. The main problems of regulating legislative and regulatory requirements for providing outstaffing services in Ukraine in current economic conditions are investigated. Explored outsourcing helps new and established businesses attract more professional employees by transferring their business processes to service providers with safer and more advanced technologies. The use of atypical forms of employment undoubtedly has its advantages, but the implementation process is hampered since it is not fully regulated by law. In general, it is necessary to study the specifics of outsourcing and outstaffing since these are promising ways to solve enterprise personnel problems.

More...

The Main Factors Leading To Code-Switching In Azerbaijan

Author(s): Aysel Eldar Soltanova / Language(s): English / Issue: 01/2023

Keywords: code-switching; integration; globalisation; mixing; interculturalism;

In today's globalised world integration of languages is a frequently experienced issue. Nowadays, people speak both English and Russian by mixing them with the Azeri language often. In linguistics, this phenomenon of mixing two languages is analysed and termed in various forms, such as code-switching, interculturalism, code-mixing etc. The study integrates quantitative research to assess interlocutors’ and respondents; attitudes toward code-switching by using close-ended questionnaires. By revealing the key aspects affecting the emergence of code-switching from historical perspectives, the paper proves that preserving the originality and uniqueness of a language is a challenge that needs to be overcome. However, nowadays, at some point and by some respondents, this tendency has not been evaluated negatively. By touching upon language contact situations based on intimate intersocietal relations and the outcome of this situation, the author used the quantitative method and data collection to conclude the goal set. Based on the background information of the respective community, the data and calculations are compiled systematically in tables and graphs for further analysis. The research outcome shows that education and other socio-economic relations are vital in protecting the existence and identities of languages. Moreover, the respondents' attitudes toward growing tendency helped to demonstrate the position and perspectives of people from different genders, backgrounds, and occupations.

More...

Comparative Analysis of the Effectiveness of Polymerase Chain Reaction and Microscopy in Malaria Diagnosis

Author(s): Ismail Muhammad,Tanko Mahmoud Mohammed,Asiya Muhammad Usman,Bala Abubakar / Language(s): English / Issue: 01/2023

Keywords: Malaria Diagnosis; Polymerase Chain Reaction; Microscopy; Sensitivity; Specificity; Accuracy;

Malaria is a life-threatening parasitic disease which causes enormous morbidity and mortality in tropical African countries. Successful prevention and treatment of infected individuals heavenly depend on successful diagnosis using recommended techniques. These routine laboratory techniques have different performance indices. Therefore, this study aimed to evaluate the performance of Polymerase Chain Reaction and Microscopy in malaria diagnosis. A total of two hundred consented study subjects were randomly selected and enrolled for the research. Vein puncture technique was use to collect venus blood from the subjects and analysed using microscopy and Polymerase chain Reaction. DNA samples were extracted using Quick-DNA™ Miniprep Plus Kit with catalogue No. D4069. 18SrRNA gene of Plasmodium falciparum from chromosome 13 was amplified using the primers F5’AACAGACGGGTAGTCATGATTGAG3’ R5’GTATCTGATCGTCTTCACTCCC3’. Malaria prevalence of 167(83.50%) and 105(52.5%) were recorded using microscopy and Polymerase Chain Reaction. Microscopy had a sensitivity, specificity, Positive predictive value and negative predictive value of 84.91, 23.40, 55.53 and 57.89%, respectively, with an overall accuracy value of 0.81. Polymerase Chain Reaction had a sensitivity value of 53.89%, specificity of 54.54%, positive predictive value of 85.79% and Negative predictive value of 18.94% with an overall accuracy of 0.54. Microscopy and Polymerase Chain Reaction demonstrated significant accuracy and relatively good performance indices. Therefore Microscopy and Polymerase Chain Reaction are highly recommended as malaria diagnostic techniques, and further research should be carried out to determine the influence of some biological factors of both the parasite and the host on the outcome of the diagnosis using both Polymerase Chain Reaction and microscopy.

More...

Effect of Facilities Performance and Quality on User’s Satisfaction with Facilities Provided in Industrial Training Fund Building Maitama, Abuja

Author(s): Joel Olaifa Oluwadare,Adeyemi Adegbenga,Muhammad Umar Bello / Language(s): English / Issue: 02-03/2023

Keywords: Facilities Performance; Quality; Facilities Provided; User's Satisfaction; Abuja;

The study investigated user satisfaction and performance of facilities management service delivery in private high-rise buildings using the industrial training fund (ITF) house Maitama, Abuja, as a study area. Survey research was carried out through the use of a questionnaire instrument. Three hundred fifty questionnaires were administered to users, of which 304 were retrieved. The simple random sampling technique was adopted for the study, while data obtained from the field were analysed using statistical packages for social. The study found that only pest control services, security facilities (e.g. CCTV), parking facilities, and fire extinguishers were rated well by the respondents in the study area. Results also indicate that users were delighted with leisure facilities (e.g. seating bench), refuse disposal facilities, intercom system and TV reception, and recreational facilities and were satisfied too with fire alarms. Users are happy with the pest control systems in the ITF building, security facilities, parking, fire extinguishers, electricity supply systems, water supply systems and air conditioning. Further findings show that facilities performance explains 78.9% of the variance in user satisfaction which is highly significant (Sig. = .000) as indicated by the F-value of 394.4. Furthermore, standardised Beta coefficients indicate that quality has the most significant beta coefficient of 0.826, thus making the most substantial contribution in explaining user satisfaction which means facilities' performance and quality have a positive and significant effect on user satisfaction. The study concluded that ITF building Maitama, Abuja facilities are performing satisfactorily. This suggests that the building owners and operators must put substantial provisions in place to perform satisfactorily. Finally, the study recommended that owners and management of high-rise buildings must recognise the need to improve the effectiveness of Facilities service to make the buildings more functional and comfortable for users.

More...

The Influence of Halal Tourism Experiences on Revisit Intention of Halal Sembalun Tourist Destinations

Author(s): Nur Aini,Akhmad Saufi,Lalu Edy Herman / Language(s): English / Issue: 02-03/2023

Keywords: halal tourism experiences; revisit intention; perceived value; religiosity; tourist satisfaction;

This study aims to determine the influence of halal tourism experiences on revisit intention with perceived value, religiosity, and tourist satisfaction as intervening variables in the halal tourist destination of Sembalun. This type of research is quantitative with associative methods of causality. The population in this study is tourists who have visited the halal tourist destination Sembalun from 2015 to 2022. The number of samples taken was 135 people. Sample determination using purposive sampling techniques, data collection tools using questionnaires distributed through google forms, and data analysis techniques using the SmartPLS application. The results showed that perceived value could mediate between halal tourism experiences and revisit intentions. Still, religiosity cannot judge between perceived value and review purpose, while tourist satisfaction can mediate between perceived value and revisit definition.

More...

The Influence of Prices, Advertising Attractiveness, Celebrity Endorsers, and Dissatisfaction with Brand Switching on Smartphone Consumers in Mataram City, Indonesia

Author(s): Muhammad At-Thariq,Handry Sudiartha Athar,Lalu M. Furkan / Language(s): English / Issue: 02-03/2023

Keywords: : Price; Advertising Attractiveness; Celebrity Endorser; Consumer Dissatisfaction; Brand Switching;

This research aims to determine the influence of price, advertising attractiveness, celebrity endorsers, and consumer dissatisfaction with brand switching. The population of this study is people who live in the city of Mataram, Indonesia. This research recruits one hundred respondents using the purposive sampling technique. Due to the relatively small number of samples, this study considered analysis using SEM Analysis with the help of the Smart-PLS Program. The results showed a positive and significant influence of all independent variables: price, advertising attractiveness, celebrity endorser, and consumer dissatisfaction on brand switching. The results of this study can be a reference and consideration for companies in determining prices. In marketing smartphone products, companies must also carefully choose the correct public figure to become a brand ambassador because a figure's good image indirectly increases customer trust. The right public figure must also be supported by advertising that is easily remembered and memorable for customers.

More...

The Effect of Broad Scope, Timeliness, Aggregation and Integration on Managerial Performance at "POS Indonesia" in Lombok, Indonesia

Author(s): Melsa Apsasi,Budi Santoso,Saipul Arni Muhsyaf / Language(s): English / Issue: 02-03/2023

Keywords: Broad Scope; Timeliness; Aggregation; Integration; Managerial Performance;

This study aims to analyse the effect of the characteristics of management accounting information systems in terms of broad scope, timeliness, aggregation, and integration aspects on managerial performance. The object used in this study is POS Indonesia in Lombok, with a total population of 145 employees. The sampling technique used purposive sampling; as many as 110 employees were selected as respondents based on the specified criteria. This study uses quantitative methods with primary data types. It can be concluded from the four characteristics of the management accounting information system only the timeliness aspect that positively influences managerial performance. In contrast, broad scope, aggregation, and integration aspects do not affect organisational performance.

More...

Management of Educational Facilities and Infrastructure to Support Centre Model Learning for Kindergarten Teachers It Baitusshalihin Banda Aceh, Indonesia

Author(s): Novita Husnidar,Murniati Murniati,Niswanto Niswanto / Language(s): English / Issue: 02-03/2023

Keywords: Management; Facilities and infrastructure; Education; Center model learning;

Good management of educational facilities and infrastructure can create an effective learning process. The research aims to correctly and realistically describe the management of educational facilities and infrastructure to support learning centre models for IT Baitusshalihin Banda Aceh Kindergarten teachers. This research uses a descriptive method with a qualitative approach. Data collection techniques include observation, interviews, and documentation studies. The research subjects are the Principal, the Teacher Council, and the School Staff. The study results show that: 1) The planning process for educational facilities and infrastructure needs includes the implementation of work meetings attended by school principals, teachers, and staff who are prepared based on the vision and mission of the school and implemented before the learning process begins. 2) Procurement of educational facilities and infrastructure is done by utilizing the surrounding environment and purchasing goods arranged in the RKAS using independent funds and BOP. 3) Maintenance is carried out by giving authority to each centre teacher as the person in charge of making an inventory book. 4) The school principal carries out supervision by supervising. 5) The obstacle faced in the management of educational facilities and infrastructure is damage to the learning media used by students in the afternoon.

More...